"Illumina Laboratory Services, Illumina"[submitter] AND "GJA5"[gene] - ClinVar

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 38

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 292436	NM_181703.4(GJA5):c.*1396G>A	GJA5	Single nucleotide variant (3 prime UTR variant)	Familial atrial fibrillation	GLikely benign
Select item 292437	NM_181703.4(GJA5):c.*1259C>T	GJA5	Single nucleotide variant (3 prime UTR variant)	Familial atrial fibrillation	GUncertain significance
Select item 292438	NM_181703.4(GJA5):c.*1211A>G	GJA5	Single nucleotide variant (3 prime UTR variant)	Familial atrial fibrillation	GUncertain significance
Select item 292439	NM_181703.4(GJA5):c.*617TGGTATGTACCTCTGGCAAATGCCC[3]	GJA5	Microsatellite (3 prime UTR variant)	Familial atrial fibrillation	GLikely benign
Select item 292440	NM_181703.4(GJA5):c.*616T>C	GJA5	Single nucleotide variant (3 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 292441	NM_181703.4(GJA5):c.*608C>T	GJA5	Single nucleotide variant (3 prime UTR variant)	Familial atrial fibrillation	GLikely benign
Select item 292442	NM_181703.4(GJA5):c.*520A>T	GJA5	Single nucleotide variant (3 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 292443	NM_181703.4(GJA5):c.*508G>A	GJA5	Single nucleotide variant (3 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 875073	NM_181703.4(GJA5):c.*498A>T	GJA5	Single nucleotide variant (3 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 292444	NM_181703.4(GJA5):c.*364C>T	GJA5	Single nucleotide variant (3 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 875074	NM_181703.4(GJA5):c.*333C>G	GJA5	Single nucleotide variant (3 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 292445	NM_181703.4(GJA5):c.*60C>T	GJA5	Single nucleotide variant (3 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 292446	NM_181703.4(GJA5):c.*46T>C	GJA5	Single nucleotide variant (3 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 876005	NM_181703.4(GJA5):c.*22G>A	GJA5	Single nucleotide variant (3 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 292447	NM_181703.4(GJA5):c.1068A>G (p.Leu356=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 876006	NM_181703.4(GJA5):c.1057T>G (p.Ser353Ala)	GJA5 (S353A)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 292448	NM_181703.4(GJA5):c.995G>A (p.Arg332His)	GJA5 (R332H)	Single nucleotide variant (missense variant)	Chromosome 1q21.1 deletion syndrome +3 more	GConflicting classifications of pathogenicity
Select item 876987	NM_181703.4(GJA5):c.956A>T (p.Gln319Leu)	GJA5 (Q319L)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 876988	NM_181703.4(GJA5):c.938T>C (p.Ile313Thr)	GJA5 (I313T)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 632079	NM_181703.4(GJA5):c.744C>A (p.Cys248Ter)	GJA5, LOC122128420 (C248*)	Single nucleotide variant (nonsense)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 876989	NM_181703.4(GJA5):c.377C>T (p.Pro126Leu)	GJA5 (P126L)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GUncertain significance
Select item 292449	NM_181703.4(GJA5):c.369C>T (p.Tyr123=)	GJA5	Single nucleotide variant (synonymous variant)	not provided +3 more	GBenign/Likely benign
Select item 292450	NM_181703.4(GJA5):c.353G>A (p.Arg118Gln)	GJA5 (R118Q)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11 +1 more	GUncertain significance
Select item 876990	NM_181703.4(GJA5):c.348G>A (p.Glu116=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial standstill 1 +1 more	GConflicting classifications of pathogenicity
Select item 292451	NM_181703.4(GJA5):c.342C>G (p.Ala114=)	GJA5	Single nucleotide variant (synonymous variant)	Atrial fibrillation, familial, 11 +1 more	GConflicting classifications of pathogenicity
Select item 292452	NM_181703.4(GJA5):c.334G>C (p.Glu112Gln)	GJA5 (E112Q)	Single nucleotide variant (missense variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 632080	NM_181703.4(GJA5):c.241C>T (p.Gln81Ter)	GJA5 (Q81*)	Single nucleotide variant (nonsense)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 292453	NM_181703.4(GJA5):c.13A>G (p.Ser5Gly)	GJA5 (S5G)	Single nucleotide variant (missense variant)	Atrial standstill 1 +1 more	GConflicting classifications of pathogenicity
Select item 292454	NM_181703.4(GJA5):c.-27T>C	GJA5	Single nucleotide variant (5 prime UTR variant)	not provided +1 more	GBenign/Likely benign
Select item 292455	NM_005266.7(GJA5):c.-51G>C	GJA5	Single nucleotide variant (5 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 292456	NM_005266.7(GJA5):c.-61A>G	GJA5	Single nucleotide variant (5 prime UTR variant)	Familial atrial fibrillation +2 more	GBenign/Likely benign
Select item 292457	NM_005266.7(GJA5):c.-67G>A	GJA5	Single nucleotide variant (5 prime UTR variant)	not provided +1 more	GConflicting classifications of pathogenicity
Select item 292458	NM_005266.7(GJA5):c.-68C>T	GJA5	Single nucleotide variant (5 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 292459	NM_005266.7(GJA5):c.-108G>A	GJA5	Single nucleotide variant (5 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 875121	NM_005266.7(GJA5):c.-125C>T	GJA5	Single nucleotide variant (5 prime UTR variant)	Atrial fibrillation, familial, 11	GUncertain significance
Select item 368828	NM_005266.6(GJA5):c.-152G=	GJA5	Single nucleotide variant (genic upstream transcript variant)	Familial atrial fibrillation	GLikely benign
Select item 368829	NM_005266.6(GJA5):c.-175G>A	GJA5	Single nucleotide variant (genic upstream transcript variant)	Familial atrial fibrillation	GLikely benign
Select item 1803806	GRCh37/hg19 1q21.1-21.2(chr1:146493131-147831043)x1	ACP6, BCL9 +6 more	Copy number loss	not provided	GPathogenic

ClinVar

Result Filters

Classification type

Germline classification

Types of conflicts

Molecular consequence

Variation type

Variation size

Variant length

Review status

Additional filters

Search results

Items: 38